List of top Questions asked in NEET (UG)

Match List I with List II.

List I		List II
A.	Common cold	I.	Plasmodium
B.	Haemozoin	II.	Typhoid
C.	Widal test	III.	Rhinoviruses
D.	Allergy	IV.	Dust mites

Choose the correct answer from the options given below:

Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli ?

Which of the following statements is incorrect?

Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in human body :

Which of the following is not a natural/traditional contraceptive method?

Match List I with List II

List I		List II
A	Lipase	I	Peptide bond
B	Nuclease	II	Ester bond
C	Protease	III	Glycosidic bond
D	Amylase	IV	Phosphodiester bond

Choose the correct answer from the options given below:

Match List I with List II

List I		List II
A	Pons	I	Provides additional space for Neurons, regulates posture and balance.
B	Hypothalamus	II	Controls respiration and gastric secretions.
C	Medulla	III	Connects different regions of the brain.
D	Cerebellum	IV	Neurosecretory cells

Choose the correct answer from the options given below:

Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’

Match List I with List II

List I		List II
A	Cocaine	I	Effective sedative in surgery
B	Heroin	II	Connabis sativa
C	Morphine	III	Erythroxylum
D	Marijuana	IV	Papaver somniferum

Choose the correct answer from the options given below:

The “Ti plasmid” of Agrobacterium tumefaciens stands for

Match List I with List II

List I (Sub Phases of Prophase I)		List II (Specific characters)
A	Diakinesis	I	Synaptonemal complex formation
B	Pachytene	II	Completion of terminalisation of chiasmata
C	Zygotene	III	Chromosomes look like thin threads
D	Leptotene	IV	Appearance of recombination nodules

Choose the correct answer from the options given below:

Match List I with List II

List I		List II
A	Pleurobrachia	I	Mollusca
B	Radula	II	Ctenophora
C	Stomochord	III	Osteichthyes
D	Air bladder	IV	Hemichordata

Choose the correct answer from the options given below:

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : FSH acts upon ovarian follicles in female and Leydig cells in male.
Reason R : Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being.
In the light of the above statements, choose the correct answer from the options given below :

Match List I with List II

List I		List II
A	Down’s syndrome	I	11th chormosome
B	α-Thalassemia	II	‘X’ chromosome
C	β-Thalassemia	III	21st chromosome
D	Klinefelter’s syndrome	IV	16th chromosome

Choose the correct answer from the options given below:

Match List I with List II

List I		List II
A	Expiratory capacity	I	Expiratory reserve volume + Tidal volume + Inspiratory reserve volume
B	Functional residual capacity	II	Tidal volume + Expiratory reserve volume
C	Vital capacity	III	Tidal volume + Inspiratory reserve volume
D	Inspiratory capacity	IV	Expiratory reserve volume + Residual volume

Choose the correct answer from the options given below:

Match List I with List II

List I		List II
A	Typhoid	I	Fungus
B	Leishmaniasis	II	Nematode
C	Ringworm	III	Protozoa
D	Filariasis	IV	Bacteria

Choose the correct answer from the options given below:

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

Match List I with List II

List I		List II
A	α –I antitrypsin	I	Cotton bollworm
B	Cry IAb	II	ADA deficiency
C	Cry IAc	III	Emphysema
D	Enzyme replacement therapy	IV	Corn borer

Choose the correct answer from the options given below:

Which of the following is not a steroid hormone?

Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent)
A. Homo habilis 
B. Homo sapiens 
C. Homo neanderthalensis 
D. Homo erectus
Choose the correct sequence of human evolution from the options given below:

Which of the following is not a component of Fallopian tube?

The flippers of the Penguins and Dolphins are the example of the

In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on

Following are the stages of pathway for conduction of an action potential through the heart
A. AV bundle 
B. Purkinje fibres 
C. AV node 
D. Bundle branches 
E. SA node
Choose the correct sequence of pathway from the options given below

Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem,thus, increasing the yield?