List of top Biology Questions

Following are the diagrams of entry of pollen tube into ovule. Identify the type A and B.
 
Give any four points of significance of double fertilization. 
 

Give any four significances of fertilization in human.
Mention the names of any two organs each derived from ectoderm and mesoderm.
What is polymerase chain reaction (PCR)?
Describe three steps involved in mechanism of PCR.
Give reason – Water acts as thermal buffer.
Draw a neat and proportionate diagram of root hair and label mitochondria, nucleus, and vacuole.
What is composition of bio-gas?
Mention any four benefits of bio-gas.
Describe the steps in breathing.
Differentiate between sympathetic and parasympathetic nervous system with reference to:
a. Pre and post ganglionic nerve fibres.
b. Effect on heart beat.
Give reason – All spinal nerves are of mixed type.
Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
\( 5' \text{GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA} 3' \)
What is a connecting link?
Which fossil animal is considered as the connecting link between reptiles and birds? Give any one character of each class found in it.
What is spermatogenesis?
Draw a neat and labelled diagram of spermatogenesis.
Draw a neat diagram of the conducting system of human heart and label AV node, Bundle of His, and Purkinje fibres.
What is biofortification?
Mention one example each of fortification with reference to –
a. Amino acid content
b. Vitamin-C content
Define the terms:
Genetic drift
Homologous organs
Define – Imbibition
Explain how imbibition helps root hairs in adsorption of water.
What is ex-situ conservation?
Mention any two places where the ex-situ conservation is undertaken.

Identify ‘A’ in the given graph of population growth.

Define the terms:
a. Gross Primary Productivity
b. Net Primary Productivity
A child has low BMR, delayed puberty and mental retardation. Identify the disease.
Give an example of plant having both kidney and dumb-bell shaped guard cells in stomata.
Complete the following box with reference to symptoms of mineral deficiency:
Abscission: Pre-mature fall of flowers, fruits and leaves
______: Appearance of green and non-green patches on leaves
Give reason – ABA is also known as antitranspirant.
Explain the role of chlorophyllase enzyme in banana.
Draw a neat diagram of thyroid gland and label thyroid follicle, follicular cells, and blood capillaries.
Give the name of first transgenic plant.
Which disease is caused by HPV?
Mention the name of sterile animal produced by intergeneric hybridisation.