List of top Biology Questions asked in Maharashtra Board Class XII Exam

Complete the chart showing human proteins produced by rDNA technology to treat human diseases and re-write.

Disorders / DiseasesRecombinant Proteins
Renal AnaemiaErythropoietin
AsthmaInterferon
Myocardial InfarctionTissue Plasminogen Activator
EmphysemaAlpha-1 Antitrypsin

 

Following are the diagrams of entry of pollen tube into ovule. Identify the type A and B.
 
Give any four points of significance of double fertilization. 
 

Describe any three adaptations in anemophilous flowers. Mention any one example of the anemophilous flower.
Describe any three adaptations in hydrophilous flowers. Mention any one example of the hydrophilous flower.
Give any four significances of fertilization in human.
Mention the names of any two organs each derived from ectoderm and mesoderm.
Give reason – Water acts as thermal buffer.
Draw a neat and proportionate diagram of root hair and label mitochondria, nucleus, and vacuole.
Explain three main functions of free antibodies produced by B-lymphocytes.
What is polymerase chain reaction (PCR)?
Describe three steps involved in mechanism of PCR.
Give any two functions of cerebellum.
Write the names of any four motor cranial nerves with their appropriate serial number.
Which hormones stimulate liver for glycogenesis and glycogenolysis?
Name the hormone which is responsible for apical dominance.
iA farmer wants to remove broad-leaved weeds from the jowar plantation in his field. Suggest any plant hormone to remove such weeds.
iiMention any two applications of cytokinin.
Describe the steps in breathing.
What is spermatogenesis?
Draw a neat and labelled diagram of spermatogenesis.
Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
\( 5' \text{GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA} 3' \)
What is composition of bio-gas?
Mention any four benefits of bio-gas.
What is a connecting link?
Which fossil animal is considered as the connecting link between reptiles and birds? Give any one character of each class found in it.
Differentiate between sympathetic and parasympathetic nervous system with reference to:
a. Pre and post ganglionic nerve fibres.
b. Effect on heart beat.
Give reason – All spinal nerves are of mixed type.
Draw a neat diagram of the conducting system of human heart and label AV node, Bundle of His, and Purkinje fibres.
What is ex-situ conservation?
Mention any two places where the ex-situ conservation is undertaken.
What is biofortification?
Mention one example each of fortification with reference to –
a. Amino acid content
b. Vitamin-C content
Define the terms:
Genetic drift
Homologous organs
Define – Imbibition
Explain how imbibition helps root hairs in adsorption of water.
Draw a neat diagram of thyroid gland and label thyroid follicle, follicular cells, and blood capillaries.
A child has low BMR, delayed puberty and mental retardation. Identify the disease.
Give reason – ABA is also known as antitranspirant.
Explain the role of chlorophyllase enzyme in banana.
Complete the following box with reference to symptoms of mineral deficiency:
Abscission: Pre-mature fall of flowers, fruits and leaves
______: Appearance of green and non-green patches on leaves

Identify ‘A’ in the given graph of population growth.