Question

Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
\( 5' \text{GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA} 3' \)

Hint:

DNA replication forms leading and lagging strands at the fork; count codons between start and stop for amino acids.

Answer 1

i. Diagram: Diagram of DNA replication fork.
 
ii. Amino Acid Count: 
Start codon: AUG (position 7–9). Stop codon: UAG (position 28–30). 
Coding region: AUGGAGAUGACGACAAAAUUUUACUAG (21 nucleotides). 
Number of codons = \( 21 \div 3 = 7 \). 
Subtract stop codon (not translated): 6 amino acids. 
Answer: i. Diagram labels Leading Strand, Lagging Strand, Replication Fork; ii. 6 amino acids.