List of top Questions asked in Maharashtra Class XII

Describe any three adaptations in anemophilous flowers. Mention any one example of the anemophilous flower.
Describe any three adaptations in hydrophilous flowers. Mention any one example of the hydrophilous flower.
What is polymerase chain reaction (PCR)?
Describe three steps involved in mechanism of PCR.
Give any four significances of fertilization in human.
Mention the names of any two organs each derived from ectoderm and mesoderm.
Give any two functions of cerebellum.
Write the names of any four motor cranial nerves with their appropriate serial number.
Which hormones stimulate liver for glycogenesis and glycogenolysis?
Differentiate between sympathetic and parasympathetic nervous system with reference to:
a. Pre and post ganglionic nerve fibres.
b. Effect on heart beat.
Give reason – All spinal nerves are of mixed type.
Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
\( 5' \text{GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA} 3' \)
Describe the steps in breathing.
What is spermatogenesis?
Draw a neat and labelled diagram of spermatogenesis.
What is a connecting link?
Which fossil animal is considered as the connecting link between reptiles and birds? Give any one character of each class found in it.
What is composition of bio-gas?
Mention any four benefits of bio-gas.
Define – Imbibition
Explain how imbibition helps root hairs in adsorption of water.
Draw a neat diagram of the conducting system of human heart and label AV node, Bundle of His, and Purkinje fibres.
What is biofortification?
Mention one example each of fortification with reference to –
a. Amino acid content
b. Vitamin-C content
Define the terms:
Genetic drift
Homologous organs
What is ex-situ conservation?
Mention any two places where the ex-situ conservation is undertaken.
A child has low BMR, delayed puberty and mental retardation. Identify the disease.

Identify ‘A’ in the given graph of population growth.

Complete the following box with reference to symptoms of mineral deficiency:
Abscission: Pre-mature fall of flowers, fruits and leaves
______: Appearance of green and non-green patches on leaves
Give an example of plant having both kidney and dumb-bell shaped guard cells in stomata.
Define the terms:
a. Gross Primary Productivity
b. Net Primary Productivity
Draw a neat diagram of thyroid gland and label thyroid follicle, follicular cells, and blood capillaries.
Give reason – ABA is also known as antitranspirant.
Explain the role of chlorophyllase enzyme in banana.
Calcium and Phosphate ions are balanced between blood and other tissues by ______.
Identify the INCORRECT statement.
Which of the following is a hormone releasing contraceptive?