List of top Biology Questions

Complete the following chart regarding population interaction and re-write:

Sr. No.Name of InteractionInteraction Between
1ParasitismPlasmodium and Man
2CompetitionLeopard and Lion
3CommensalismClown Fish and Sea-anemone

 

Define – Incomplete dominance.
If a red flowered Mirabilis jalapa plant is crossed with a white flowered plant, what will be the phenotypic ratio in F2 generation? Show it by a chart.
Differentiate between X-chromosome and Y-chromosome with reference to –
length of non-homologous regions
type as per position of centromere.

Complete the following chart regarding energy flow in an Ecosystem and re-write:

CategoryExamples
Primary ConsumerHerbivores
Primary ProducerGreen Plants / Phytoplankton
Tertiary ConsumerMan, Lion
Secondary ConsumerFrog, Small Fish

 

Distinguish between heterochromatin and euchromatin with reference to staining property and activity.

Complete the chart showing human proteins produced by rDNA technology to treat human diseases and re-write.

Disorders / DiseasesRecombinant Proteins
Renal AnaemiaErythropoietin
AsthmaInterferon
Myocardial InfarctionTissue Plasminogen Activator
EmphysemaAlpha-1 Antitrypsin

 

Explain three main functions of free antibodies produced by B-lymphocytes.
Name the hormone which is responsible for apical dominance.
iA farmer wants to remove broad-leaved weeds from the jowar plantation in his field. Suggest any plant hormone to remove such weeds.
iiMention any two applications of cytokinin.
Give any four significances of fertilization in human.
Mention the names of any two organs each derived from ectoderm and mesoderm.
Give reason – Water acts as thermal buffer.
Draw a neat and proportionate diagram of root hair and label mitochondria, nucleus, and vacuole.
Give any two functions of cerebellum.
Write the names of any four motor cranial nerves with their appropriate serial number.
Which hormones stimulate liver for glycogenesis and glycogenolysis?

Following are the diagrams of entry of pollen tube into ovule. Identify the type A and B.
 
Give any four points of significance of double fertilization. 
 

Describe any three adaptations in anemophilous flowers. Mention any one example of the anemophilous flower.
Describe any three adaptations in hydrophilous flowers. Mention any one example of the hydrophilous flower.
What is polymerase chain reaction (PCR)?
Describe three steps involved in mechanism of PCR.
Differentiate between sympathetic and parasympathetic nervous system with reference to:
a. Pre and post ganglionic nerve fibres.
b. Effect on heart beat.
Give reason – All spinal nerves are of mixed type.
Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
\( 5' \text{GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA} 3' \)
What is composition of bio-gas?
Mention any four benefits of bio-gas.
What is a connecting link?
Which fossil animal is considered as the connecting link between reptiles and birds? Give any one character of each class found in it.
What is spermatogenesis?
Draw a neat and labelled diagram of spermatogenesis.
Describe the steps in breathing.
What is biofortification?
Mention one example each of fortification with reference to –
a. Amino acid content
b. Vitamin-C content
Define the terms:
Genetic drift
Homologous organs
Draw a neat diagram of the conducting system of human heart and label AV node, Bundle of His, and Purkinje fibres.
Define – Imbibition
Explain how imbibition helps root hairs in adsorption of water.
What is ex-situ conservation?
Mention any two places where the ex-situ conservation is undertaken.