Question:
For the given sequence of DNA, identify the complementary sequence of bases on its mRNA from the options given below:
DNA 3'-ATGCATGCATGC-5'
For the given sequence of DNA, identify the complementary sequence of bases on its mRNA from the options given below:
DNA 3'-ATGCATGCATGC-5'
DNA 3'-ATGCATGCATGC-5'
Updated On: Apr 3, 2024
- 5'-UACGUACGUACG-3'
- 5'-TACGTACGTACG-3'
- 3'-UACGUACGUACG-5'
- 5'-GCATGCATGCAT-3'
Hide Solution
Verified By Collegedunia
The Correct Option is A
Solution and Explanation
The correct answer is (A) :5'-UACGUACGUACG-3'
Was this answer helpful?
0
0
Top Questions on Transcription
- Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’- NEET (UG) - 2024
- Biology
- Transcription
- A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
- NEET (UG) - 2024
- Biology
- Transcription
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?
- NEET (UG) - 2023
- Biology
- Transcription
- Match List - I with List- II.
List - I (Codes) List - II (Codes for) (A) UUU (I) Phenylalanine (B) AUG (II) Initiator codon (C) CUAA (III) Terminator codon (D) GUU (IV) Valine
Choose the correct answer from the options given below:- CUET (UG) - 2023
- Biology
- Transcription
- Which of the following is a stop codon?
- CUET (UG) - 2023
- Biology
- Transcription
View More Questions
Questions Asked in KCET exam
- The speed of sound in an ideal gas at a given temperature T is v. The rms speed of gas molecules at that temperature is vrms. The ratio of the velocities v and vrms for helium and oxygen gases are X and X' respectively. Then \(\frac{X}{X'}\) is equal to
- KCET - 2023
- Thermodynamics
- If \(p(\frac{1}{q}+\frac{1}{r}),q(\frac{1}{r}+\frac{1}{p}),r(\frac{1}{p}+\frac{1}{q})\) are in A.P., then p, q, r
- KCET - 2023
- Arithmetic Progression
- A stretched wire of a material whose Young's modulus Y = 2 × 1011 Nm-2 has Poisson's ratio of 0.25. Its lateral strain εl = 10-3. The elastic energy density of the wire is
- KCET - 2023
- mechanical properties of solids
- A metallic rod of length 1 m held along east-west direction is allowed to fall down freely. Given horizontal component of earth’s magnetic field BH = 3 × 10-5 T. The emf induced in the rod at an instant t = 2s after it is released is ( Take g = 10 ms-2 )
- KCET - 2023
- Faradays laws of induction
- A 60 W source emits monochromatic light of wavelength 662.5 nm. The number of photons emitted per second is
- KCET - 2023
- Quantum Physics
View More Questions