List of top Biology Questions

Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’

Given below are two statements :
Statement I : Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced. 
Statement II : Both bone marrow and thymus provide micro environments for the development and maturation of T-lymphocytes. 
In the light of above statements, choose the most appropriate answer from the options given below :

Match List I with List II:

List I		List II
A	Unicellular glandular epithelium	I	Salivary glands
B	Compound epithelium	II	Pancreas
C	Multicellular glandular epithelium	III	Goblet cells of alimentary canal
D	Endocrine glandular epithelium	IV	Moist surface of buccal cavity

Choose the correct answer from the options given below:

Match List I with List II:

List I		List II
A	RNA polymerase III	I	snRNPs
B	Termination of transcription	II	Promotor
C	Splicing of Exons	III	Rho factor
D	TATA box	IV	SnRNAs, tRNA

Choose the correct answer from the options given below:

Match List I with List II:

List I		List II
A	Exophthalmic goiter	I	Excess secretion of cortisol, moon face & hypergylcemia
B	Acromegaly	II	Hypo-secretion of thyroid hormone and stunted growth.
C	Cushing’s syndrome	III	Hyper secretion of thyroid hormone & protruding eye balls.
D	Cretinism	IV	Excessive secretion of growth hormone.

Choose the correct answer from the options given below:

Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.

Match List I with List II

List I (Types of Stamens)		List II (Example)
A	Monoadelphous	I	Citrus
B	Diadelphous	II	Pea
C	Polyadelphous	III	Lily
D	Epiphyllous	IV	China-rose

Choose the correct answer from the options given below:

Match List I with List II:

List I		List II
A	Nucleolus	I	Site of formation of glycolipid
B	Centriole	II	Organization like the cartwheel
C	Leucoplasts	III	Site for active ribosomal RNA synthesis
D	Golgi apparatus	IV	For storing nutrients

Choose the correct answer from the options given below:

Match List-I with List-II:

List-I	List-II
A. ETS Complex I	I. NADH Dehydrogenase
B. ETS Complex II	IV. Succinate Dehydrogenase
C. ETS Complex III	II. Cytochrome bc1
D. ETS Complex IV	III. Cytochrome C oxidase

Choose the correct answer from the options given below:

Match List-I with List-II :

List-I	List-II
A. Vexillary aestivation	I. Brinjal
B. Epipetalous stamens	II. Peach
C. Epiphyllous stamens	III. Pea
D. Perigynous flower	IV. Lily

Choose the correct answer from the options given below

Match List-I with List-II :

List-I	List-II
A. China rose	I. Free central
B. Mustard	II. Basal
C. Primrose	III. Axile
D. Marigold	IV. Parietal

Choose the correct answer from the options given below

Match List-I with List-II:

List-I	List-II
A. Abscisic acid	I. Promotes female flowers in cucumber
B. Ethylene	II. Helps seeds to withstand desiccation
C. Gibberellin	III. Helps in nutrient mobilisation
D. Cytokinin	IV. Promotes bolting in beet, cabbage etc

Choose the correct answer from the options given below:

Match List-I with List-II:

List-I	List-II
A. Genetically engineered Human Insulin	I. Gene therapy
B. GM Cotton	II. E. coli
C. ADA Deficiency	III. Antigen-antibody interaction
D. ELISA	IV. Bacillus thuringiensis

Choose the correct answer from the options given below:

Match List-I with List-II:

List-I	List-II
A. Metacentric chromosome	I. Chromosome has a terminal centromere
B. Sub-metacentric chromosome	II. Middle centromere forming two equal arms of chromosome
C. Acrocentric chromosome	III. Centromere is slightly away from the middle of chromosome resulting into two unequal arms
D. Telocentric chromosome	IV. Centromere is situated close to its end forming one extremely short and one very long arm

Choose the correct answer from the options given below:

Match List-I with List-II:

List-I	List-II
A. Histones	III. Positively charged basic proteins
B. Nucleosome	IV. DNA wrapped around histone octamer
C. Euchromatin	I. Loosely packed chromatin
D. Heterochromatin	II. Densely packed Chromatin

Choose the correct answer from the options given below:

Match List-I with List-II:

List-I	List-II
A. Biodiversity hotspot	I. Khasi and Jantia hills in Meghalaya
B. Sacred groves	II. World Summit on Sustainable
C. Johannesburg South Africa	III. Parthenium
D. Alien species invasion	IV. Western Ghats

Choose the correct answer from the options given below:

Match List I with List II :

List - I		List – II
A.	B-Lymphocytes	i.	Passive immunity
B.	Interferons	ii.	Cell mediated immunity
C.	T-Lymphocytes	iii.	Produce an army of proteins in response to pathogens
D.	Colostrum	iv.	Innate immunity

Choose the correct answer from the options given below :

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: Members of subphylum vertebrates possess notochord during the embryonic period. The notochord is replaced by a cartilaginous or bony vertebral column in the adult.
Reason R: Thus all chordates are vertebrates not all vertebrates are chordates.
In the light of the above statements choose the correct answer from the option given below

Match List I with List II :

List - I		List – II
A.	Squamous Epithelium	i.	Goblet cells of alimentary canal
B.	Ciliated Epithelium	ii.	Inner lining of pancreatic ducts
C.	Glandular Epithelium	iii.	Walls of blood vessels
D.	Compound Epithelium	iv.	Inner surface of Fallopian tubes

Choose the correct answer from the options given below :

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: During the transportation of gases, about 20-25 percent of \(CO_2\) is carried by Haemoglobin as carbamino-haemoglobin.
Reason R: This binding is related to high p \(CO_2\) and low p \(O_2\) in tissues.
In the light of the above statements, choose the correct answer from the options given below

Identify the wrong statements
(A) Erythropoietin is produced by juxtaglomerular cells of the kidney
(B) Leydig cells produce Androgens
(C) Atrial Natriuretic factor, a peptide hormone is secreted by the seminiferous tubules of the testes
(D) Cholecystokinin is produced by gastrointestinal tract
(E) Gastrin acts on intestinal wall and helps in the production of pepsinogen
Choose the most appropriate answer from the options given below :

Aneuploidy is a chromosomal disorder where chromosome number is not the exact copy of its haploid set of chromosomes, due to :
(a) Substitution
(b) Addition
(c) Deletion
(d) Translocation
(e) Inversion
Choose the most appropriate answer from the options given below

Given below are two statements
Statement I : RNA interference takes place in all Eukaryotic organisms as method of cellular defense.
Statement II : RNAi involves the silencing of a specific mRNA due to a complementary single-stranded RNA molecule that binds and prevents translation of mRNA
In the light of the above statements, choose the correct answer from the options given below

Given below are two statements:
Statement I: Concentrically arranged cisternae of Golgi complex are arranged near the nucleus with distinct convex cis or maturing and concave trans or forming face.
Statement II: A number of proteins are modified in the cisternae of Golgi complex before they are released from cis face.
In the light of the above statements, choose the correct answer from the option given below.

Given below are two statements:
Statements I: Concentrated urine is formed due to counter current mechanism in nephron.
Statement II: Counter current mechanism helps to maintain osmotic gradient in the medullary interstitium.
In the light of the above statements, choose the most appropriate answer from the options given below.