If the sequence of one strand of DNA is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of complementary strand in 5'→3' direction
If the sequence of one strand of DNA is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of complementary strand in 5'→3' direction
Solution and Explanation
The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is
5'- ATGCATGCATGCATGCATGCATGCATGC − 3’
Then, the sequence of complementary strand in 5' to 3' direction will be
3'- TACGTACGTACGTACGTACGTACGTACG − 5’
Therefore, the sequence of nucleotides on DNA polypeptide in 5' to 3' direction is
5'- GCATGCATGCATGCATGCATGCATGCAT− 3’
Top Questions on Molecular Basis of Inheritance
Study the given below single strand of deoxyribonucleic acid depicted in the form of a “stick” diagram with 5′ – 3′ end directionality, sugars as vertical lines and bases as single letter abbreviations and answer the questions that follow.
Name the covalent bonds depicted as (a) and (b) in the form of slanting lines in the diagram.
How many purines are present in the given “stick” diagram?
Draw the chemical structure of the given polynucleotide chain of DNA.- CBSE CLASS XII - 2025
- Biology
- Molecular Basis of Inheritance
Study the given molecular structure of double-stranded polynucleotide chain of DNA and answer the questions that follow.
(a) How many phosphodiester bonds are present in the given double-stranded polynucleotide chain?
(b) How many base pairs are there in each helical turn of double helix structure of DNA? Also write the distance between a base pair in a helix.
(c) In addition to H-bonds, what confers additional stability to the helical structure of DNA?- CBSE CLASS XII - 2025
- Biology
- Molecular Basis of Inheritance
Use the given information to select the amino acid attached to the 3′ end of tRNA during the process of translation, if the coding strand of the structural gene being transcribed has the nucleotide sequence TAC.
- CBSE CLASS XII - 2025
- Biology
- Molecular Basis of Inheritance
Student to attempt either option-(A) or (B):
(A) Write the features a molecule should have to act as a genetic material. In the light of the above features, evaluate and justify the suitability of the molecule that is preferred as an ideal genetic material.
OR
(B) Differentiate between the following:- [(i)] Polygenic Inheritance and Pleiotropy
- [(ii)] Dominance, Codominance and Incomplete dominance
- CBSE CLASS XII - 2025
- Biology
- Molecular Basis of Inheritance
- Distance between two consecutive base pairs of DNA is \rule{2cm}{0.1mm}
- CBSE Compartment XII - 2025
- Biology
- Molecular Basis of Inheritance
Questions Asked in CBSE CLASS XII exam
- Two point charges \( 5 \, \mu C \) and \( -1 \, \mu C \) are placed at points \( (-3 \, \text{cm}, 0, 0) \) and \( (3 \, \text{cm}, 0, 0) \), respectively. An external electric field \( \vec{E} = \frac{A}{r^2} \hat{r} \) where \( A = 3 \times 10^5 \, \text{V m} \) is switched on in the region. Calculate the change in electrostatic energy of the system due to the electric field.
- CBSE CLASS XII - 2025
- Electrostatics
Student to attempt either option (A) or (B).
(A)
(i) Describe the process of megasporogenesis in an angiosperm.
(ii) Draw a diagram of a mature embryo sac of the angiosperm. Label its any four parts.
OR
(B) The reproductive cycle in the female primates is called menstrual cycle. The first menstruation begins at puberty.
Answer the following questions:
(i) Name the four phases of menstrual cycle in a proper sequence.
(ii) How long does the menstrual phase last in a menstrual cycle?
(iii) When and why hormones estrogen and progesterone reach their peak levels respectively, in the menstrual cycle?
(iv) Give the significance of LH surge.- CBSE CLASS XII - 2025
- sexual reproduction in flowering plants
- Your school is organizing an Education Fair in the school premises. As the Head boy / Head girl of Sunshine Public School, Agra, draft a notice informing students of Classes IX – XII about the fair. Include other necessary details. You are Muskan / Manoj. Put your notice in a box.
- CBSE CLASS XII - 2025
- Writing Skills
- Nita, Vidur and Mita were partners in a firm sharing profits and losses in the ratio of 3 : 4 : 1. On 1st April 2024, they decided to admit Samir as a new partner. The new profit sharing ratio between Nita, Vidur, Mita and Samir will now be 1 : 1 : 1 : 1. The balance sheet of Nita, Vidur and Mita before Samir’s admission showed machinery at ₹ 6,00,000. On the date of admission, it was found that the machinery is overvalued by 20%. The value of machinery shown in the new Balance Sheet after Samir’s admission will be :
- CBSE CLASS XII - 2025
- Admission of a Partner
- Altima Ltd. invited applications for 2,00,000 equity shares of ₹ 10 at a premium of ₹ 4 per share. Amount payable:
On application and allotment – ₹ 7 (incl. ₹ 1 premium)
On first and final call – Balance.
Applications received for 2,40,000 shares. 30,000 rejected. Manvi allotted 4,000 shares failed to pay first and final call. Her shares were forfeited. These were reissued at ₹ 4 per share fully paid-up.
Pass journal entries in the books of Altima Ltd.- CBSE CLASS XII - 2025
- Accounting for Share Capital
Concepts Used:
Transcription
The very first stage of gene expression is the procedure of transcription. In this procedure, mRNA is the place where the genetic information is stored which later aids in encoding a protein. In this process, the DNA strand acts as a guide in the making of mRNA. Despite the fact that there is one exception which is adenine base pairs with uracil instead of thymine.
Transcription Unit:
The transcription unit is a set of freshly combined RNA molecules that have been transcribed from DNA. The cause is to encode at least one gene. A protein that has been encoded or encrypted with a DNA transcription unit may have a coding sequence. Transcription has a lower copying fidelity rate when differentiated from DNA replication.
The Stages of Transcription:
The procedure of transcription is enzymatically catalyzed into three steps:
- Initiation
- Elongation
- Termination