If the sequence of one strand of DNA is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of complementary strand in 5'→3' direction
The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is
5'- ATGCATGCATGCATGCATGCATGCATGC − 3’
Then, the sequence of complementary strand in 5' to 3' direction will be
3'- TACGTACGTACGTACGTACGTACGTACG − 5’
Therefore, the sequence of nucleotides on DNA polypeptide in 5' to 3' direction is
5'- GCATGCATGCATGCATGCATGCATGCAT− 3’
The very first stage of gene expression is the procedure of transcription. In this procedure, mRNA is the place where the genetic information is stored which later aids in encoding a protein. In this process, the DNA strand acts as a guide in the making of mRNA. Despite the fact that there is one exception which is adenine base pairs with uracil instead of thymine.
The transcription unit is a set of freshly combined RNA molecules that have been transcribed from DNA. The cause is to encode at least one gene. A protein that has been encoded or encrypted with a DNA transcription unit may have a coding sequence. Transcription has a lower copying fidelity rate when differentiated from DNA replication.
The procedure of transcription is enzymatically catalyzed into three steps: