Question

Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.

Hint:

The number of amino acids in a polypeptide chain is determined by counting the codons in the mRNA, excluding the start and stop codons.

Answer 1

Unfortunately, I cannot directly draw diagrams in this text format. However, you can follow these steps to draw the diagram of eukaryotic DNA replication: Step 1: Drawing the Replication Fork.
Draw the double helix of the DNA strand. At the replication fork, you will have the two separated strands with helicase unwinding the DNA.
Step 2: Labeling Parts.
- Label the leading strand (the strand that is synthesized continuously).
- Label the lagging strand (the strand synthesized discontinuously in Okazaki fragments).
- Label the DNA polymerase enzyme responsible for adding nucleotides.
Step 3: Conclusion.
The replication process involves the synthesis of new DNA strands, with key enzymes such as helicase and DNA polymerase playing crucial roles.
ii. How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5' GCCACAUGGGAGGACAAAAAAUUUCUAGAAA3'
Solution:
Step 1: Understanding the mRNA sequence.
Each set of three nucleotides (codon) in the mRNA corresponds to an amino acid. The start codon (AUG) indicates the beginning of translation. Step 2: Counting Codons.
The given mRNA sequence is: 5' GCCACAUGGGAGGACAAAAAAUUUCUAGAAA3'
The translation begins at the first "AUG" codon. Counting the codons after the "AUG" start codon: \[ \text{AUG (Start)} - GAG - GAC - AAA - AAU - UCU - UAG (Stop) \] There are 6 amino acids in the polypeptide chain.
Step 3: Conclusion.
The polypeptide chain formed will consist of 6 amino acids.