Question:
Which cells of 'Crypts of Lieberkuhn' secrete antibacterial lysozyme?
Which cells of 'Crypts of Lieberkuhn' secrete antibacterial lysozyme?
Updated On: May 21, 2024
- Argentaffin cells
- Paneth cells
- Zymogen cells
- Kupffer cells
Hide Solution
Verified By Collegedunia
The Correct Option is B
Solution and Explanation
The correct option is (B): Paneth cells.
Was this answer helpful?
0
0
Top Questions on Digestion and absorption
- Match List I with List II
List I List II A Lipase I Peptide bond B Nuclease II Ester bond C Protease III Glycosidic bond D Amylase IV Phosphodiester bond
Choose the correct answer from the options given below:- NEET (UG) - 2024
- Biology
- Digestion and absorption
- The enzyme present in the gastric juice of infants is:
- TS EAMCET - 2024
- Zoology
- Digestion and absorption
Match List I with List II
List I (Cells) List II (Secretion) A Peptic cells I Mucus B Goblet cells II Bile juice C Oxyntic cells III Proenzyme pepsinogen D Hepatic cells IV HCl and intrinsic factor for absorption of vitamin B12 Choose the correct answer from the options given below:
- NEET (UG) - 2023
- Biology
- Digestion and absorption
- Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by
- NEET (UG) - 2023
- Biology
- Digestion and absorption
- Due to protein deficiency, which disorder is seen in infants?
- MHT CET - 2023
- Biology
- Digestion and absorption
View More Questions
Questions Asked in NEET exam
- The two-dimensional motion of a particle, described by \( \vec{r} = (\hat{i} + 2\hat{j}) A \cos \omega t \) is a/an:
1. parabolic path
2. elliptical path
3. periodic motion
4. simple harmonic motion
Choose the correct answer from the options given below:- NEET (UG) - 2024
- simple harmonic motion
- Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’- NEET (UG) - 2024
- Transcription
- Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b).
- NEET (UG) - 2024
- The Flower
- The reagents with which glucose does not react to give the corresponding tests/products are
A. Tollen's reagent
B. Schiff's reagent
C. HCN
D NH2OH
E. NaHSO3
Choose the correct options from the given below:- NEET (UG) - 2024
- Chemical Reactions
- \(^{290}_{82}X\stackrel{\alpha}{\rightarrow}Y\stackrel{e^+}{\rightarrow}Z\stackrel{\beta^-}{\rightarrow}P\stackrel{e^-}{\rightarrow}Q\)
In the nuclear emission stated above, the mass number and atomic number of the product Q respectively, are :- NEET (UG) - 2024
- Nuclear physics
View More Questions