Question:
What is the criterion for DNA fragments movement on agarose gel during gel electrophoresis?
What is the criterion for DNA fragments movement on agarose gel during gel electrophoresis?
Updated On: May 21, 2024
- The larger the fragment size, the farther it moves
- The smaller the fragment size, the farther it moves
- Positively charged fragments move to farther end
- Negatively charged fragments do not move
Hide Solution
Verified By Collegedunia
The Correct Option is B
Solution and Explanation
The correct option is (B): The smaller the fragment size, the farther it moves.
Was this answer helpful?
0
0
Top Questions on The DNA
- According to Chargaff's Rule, in a DNA molecule, the amount of adenine (A) is always equal to the amount of ______.
- What is the fate of a piece of DNA carrying only gene of interest which is transfered in to an alien organism?
A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.
B. It may get integrated into the genome of the recipient.
C. It may multiple and be inherited along with the host DNA.
D. The alien piece of DNA is not an integral part of chromasame.
E. It shows ability to replicate.
Choose the correct answer from the options given below: - Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:
- The DNA present in chloroplast is:
- Who discovered DNA?
View More Questions
Questions Asked in NEET exam
- The two-dimensional motion of a particle, described by \( \vec{r} = (\hat{i} + 2\hat{j}) A \cos \omega t \) is a/an:
1. parabolic path
2. elliptical path
3. periodic motion
4. simple harmonic motion
Choose the correct answer from the options given below:- NEET (UG) - 2024
- simple harmonic motion
- Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’- NEET (UG) - 2024
- Transcription
- Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b).
- NEET (UG) - 2024
- The Flower
- The reagents with which glucose does not react to give the corresponding tests/products are
A. Tollen's reagent
B. Schiff's reagent
C. HCN
D NH2OH
E. NaHSO3
Choose the correct options from the given below:- NEET (UG) - 2024
- Chemical Reactions
- \(^{290}_{82}X\stackrel{\alpha}{\rightarrow}Y\stackrel{e^+}{\rightarrow}Z\stackrel{\beta^-}{\rightarrow}P\stackrel{e^-}{\rightarrow}Q\)
In the nuclear emission stated above, the mass number and atomic number of the product Q respectively, are :- NEET (UG) - 2024
- Nuclear physics
View More Questions