Question:
The hepatic portal vein drains blood to liver from
The hepatic portal vein drains blood to liver from
Updated On: May 21, 2024
- Heart
- Stomach
- Kidneys
- Intestine
Hide Solution
Verified By Collegedunia
The Correct Option is D
Solution and Explanation
The correct option is (D): Intestine.
Was this answer helpful?
0
0
Top Questions on body fluids and circulation
- Which of the following acts as hemoglobin (Hb) in the blood buffer system?
- MHT CET - 2025
- Biology
- body fluids and circulation
- Match List I with List II:Choose the correct answer from the options given below:
List I
List II
A P wave I Heart muscles are electrically silent. B QRS complex II Depolarisation of ventricles. C T wave III Depolarisation of atria. D T-P gap IV Repolarisation of ventricles. - NEET (UG) - 2024
- Biology
- body fluids and circulation
- How many heartbeats does a person have in 1 minute on average?
- MHT CET - 2024
- Biology
- body fluids and circulation
- Cerebrospinal fluid (CSF) uses were given below. Identify the incorrect use by eliminating it.
- MHT CET - 2024
- Biology
- body fluids and circulation
- In an ECG of a normal healthy person, the duration of the R-R interval is about:
- TS EAMCET - 2024
- Zoology
- body fluids and circulation
View More Questions
Questions Asked in NEET exam
- A bob is whirled in a horizontal circle by means of a string at an initial speed of 10 rpm. If the tension in the string is quadrupled while keeping the radius constant, the new speed is:
- NEET (UG) - 2024
- Circular motion
- The two-dimensional motion of a particle, described by \( \vec{r} = (\hat{i} + 2\hat{j}) A \cos \omega t \) is a/an:
1. parabolic path
2. elliptical path
3. periodic motion
4. simple harmonic motion
Choose the correct answer from the options given below:- NEET (UG) - 2024
- simple harmonic motion
- Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’- NEET (UG) - 2024
- Transcription
- Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b).
- NEET (UG) - 2024
- The Flower
- The reagents with which glucose does not react to give the corresponding tests/products are
A. Tollen's reagent
B. Schiff's reagent
C. HCN
D NH2OH
E. NaHSO3
Choose the correct options from the given below:- NEET (UG) - 2024
- Chemical Reactions
View More Questions