Reverse transcription results in the synthesis of
- cDNA
- mRNA
- tRNA
- rRNA.
The Correct Option is A
Solution and Explanation
Top Questions on Transcription
- Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’- NEET (UG) - 2024
- Biology
- Transcription
- A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
- NEET (UG) - 2024
- Biology
- Transcription
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?
- NEET (UG) - 2023
- Biology
- Transcription
- Which of the following is a stop codon?
- CUET (UG) - 2023
- Biology
- Transcription
- Match List - I with List- II.
List - I (Codes) List - II (Codes for) (A) UUU (I) Phenylalanine (B) AUG (II) Initiator codon (C) CUAA (III) Terminator codon (D) GUU (IV) Valine
Choose the correct answer from the options given below:- CUET (UG) - 2023
- Biology
- Transcription
Questions Asked in COMEDK UGET exam
- A $2\,kg$ mass lying on a table is displaced in the horizontal direction through $50\,cm$. The work done by the normal reaction will be
- COMEDK UGET - 2015
- work, energy and power
- The numbers of $ {H^+}$ ions present in 1 mL of a solution whose pH is 13
- COMEDK UGET - 2015
- Equilibrium
- A mixture of methylamine and dimethylamine is given to you. The reagents used to separate the components of the mixture are
- $\cot^{-1} (21) + \cot^{-1} (13) + \cot^{-1} (-8) =$
- COMEDK UGET - 2015
- Inverse Trigonometric Functions
- Pick the incorrect statement among those given below.
- COMEDK UGET - 2015
- Chemical bonding and molecular structure
Concepts Used:
Transcription
The very first stage of gene expression is the procedure of transcription. In this procedure, mRNA is the place where the genetic information is stored which later aids in encoding a protein. In this process, the DNA strand acts as a guide in the making of mRNA. Despite the fact that there is one exception which is adenine base pairs with uracil instead of thymine.
Transcription Unit:
The transcription unit is a set of freshly combined RNA molecules that have been transcribed from DNA. The cause is to encode at least one gene. A protein that has been encoded or encrypted with a DNA transcription unit may have a coding sequence. Transcription has a lower copying fidelity rate when differentiated from DNA replication.
The Stages of Transcription:
The procedure of transcription is enzymatically catalyzed into three steps:
- Initiation
- Elongation
- Termination