Question:
D(+) glucose reacts with hydroxylamine and yields an oxime. The structure of the oxime would be:
D(+) glucose reacts with hydroxylamine and yields an oxime. The structure of the oxime would be:
Updated On: May 22, 2024
Hide Solution
Verified By Collegedunia
The Correct Option is C
Solution and Explanation
The correct option (C): 
.
.Was this answer helpful?
0
0
Top Questions on Biomolecules
- Which one of the two curves is relevant in present days with respect to human population in our country and why?
- CBSE CLASS XII - 2024
- Biology
- Biomolecules
Explain the mechanism of switching ‘on’ of the structural genes of lac operon.
- CBSE CLASS XII - 2024
- Biology
- Biomolecules
- Metabolic acidosis is associated with decreased plasma level of
- IIT JAM BT - 2024
- Biology
- Biomolecules
- Which of the following act as epimeric pair?
- JIPMER MBBS - 2019
- Chemistry
- Biomolecules
- What can be same in a mango/Mangiferaindica cell and human/Homo sapiens cells
- JIPMER MBBS - 2019
- Biology
- Biomolecules
View More Questions
Questions Asked in NEET exam
- Consider the following reaction in a sealed vessel at equilibrium with concentrations of
N2 = 3.0 × 10–3 M, O2 = 4.2 × 10–3 M and NO = 2.8 × 10–3 M.
2NO(g)⇋N2(g) + O2(g)
If 0.1 mol L–1 of NO(g) is taken in a closed vessel, what will be degree of dissociation (a) of NO(g) at equilibrium?- NEET (UG) - 2024
- Equilibrium
- Match List I with List II:Choose the correct answer from the options given below:
List I
List II
A Mesozoic Era I Lower invertebrates B Proterozoic Era II Fish & Amphibia C Cenozoic Era III Birds & Reptiles D Paleozoic Era IV Mammals - NEET (UG) - 2024
- Origin Of Life
- If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then
A. the charge stored in it, increases.
B. the energy stored in it, decreases.
C. its capacitance increases.
D. the ratio of charge to its potential remains the same.
E. the product of charge and voltage increases.
Choose the most appropriate answer from the options given below :- NEET (UG) - 2024
- Capacitors in Parallel and in Series
- Match List I with List II
List I List II A Lipase I Peptide bond B Nuclease II Ester bond C Protease III Glycosidic bond D Amylase IV Phosphodiester bond
Choose the correct answer from the options given below:- NEET (UG) - 2024
- Digestion and absorption
- Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’- NEET (UG) - 2024
- Transcription
View More Questions