Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’
3’TACATGGCAAATATCCATTCA5’
- 5’AUGUACCGUUUAUAGGUAAGU3’
- 5’AUGUAAAGUUUAUAGGUAAGU3’
- 5’AUGUACCGUUUAUAGGGAAGU3’
- 5’ATGTACCGTTTATAGGTAAGT3’
The Correct Option is A
Solution and Explanation
DNA-dependent RNA polymerase transcribes the template strand of DNA to RNA. In this case, the RNA sequence will be complementary to the given DNA template:
Given DNA template strand (3' → 5'): TACATGGCAAATATCCATTCA
Transcribed RNA strand (5' → 3'): AUGUACCGUUUAUAGGUAAGU
Thus, the correct answer is (1) 5'AUGUACCGUUUAUAGGUAAGU3'.
Top Questions on Transcription
The process of copying the genetic information from one strand of DNA into RNA is termed as transcription. The principle of complementarity of bases governs the process of transcription, also except that uracil comes in place of thymine. Study the complete transcription unit given below and answer the following questions:
Identify (C) and (D) in the diagram, mention their significance in the process of transcription.
- CBSE CLASS XII - 2025
- Biology
- Transcription
The process of copying the genetic information from one strand of DNA into RNA is termed as transcription. The principle of complementarity of bases governs the process of transcription, also except that uracil comes in place of thymine. Study the complete transcription unit given below and answer the following questions:
Describe the location of (C) and (D) in the transcription unit.
- CBSE CLASS XII - 2025
- Biology
- Transcription
The process of copying the genetic information from one strand of DNA into RNA is termed as transcription. The principle of complementarity of bases governs the process of transcription, also except that uracil comes in place of thymine. Study the complete transcription unit given below and answer the following questions:
Identify coding strand and template strand of DNA in the transcription unit.
- CBSE CLASS XII - 2025
- Biology
- Transcription
The process of copying the genetic information from one strand of DNA into RNA is termed as transcription. The principle of complementarity of bases governs the process of transcription, also except that uracil comes in place of thymine. Study the complete transcription unit given below and answer the following questions:
Name the main enzyme involved in the process of transcription.
- CBSE CLASS XII - 2025
- Biology
- Transcription
- A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
- NEET (UG) - 2024
- Biology
- Transcription
Questions Asked in NEET exam
- Match List I with List IIChoose the correct answer from the options given below:
List I List II A Down’s syndrome I 11th chormosome B α-Thalassemia II ‘X’ chromosome C β-Thalassemia III 21st chromosome D Klinefelter’s syndrome IV 16th chromosome - NEET (UG) - 2024
- Genetic Disorders
The velocity (v) - time (t) plot of the motion of a body is shown below :
The acceleration (a) - time(t) graph that best suits this motion is :- NEET (UG) - 2024
- speed and velocity
- An iron bar of length L has magnetic moment M. It is bent at the middle of its length such that the two arms make an angle 60° with each other. The magnetic moment of this new magnet is :
- NEET (UG) - 2024
- Magnetic Field
- A tightly wound \(100\) turns coil of radius \(10 cm\) carries a current of \( 7 A\). The magnitude of the magnetic field at the centre of the coil is (Take permeability of free space as \(4\pi×10^{-7}\) SI units):
- NEET (UG) - 2024
- Magnetic Field
- Given below are two statements:
Statement I: Mitochondria and chloroplasts both double membranes bound organelles.
Statement II: Inner membrane of mitochondria is relatively less permeable, as compared chloroplast. I
In the light of the above statements, choose the mis appropriate answer from the options given below- NEET (UG) - 2024
- Cell structure and organelles