| DNA | - | T | A | C | A | T | G | G | C | A | A | A | T | A | T | C | C | A | T | T | C | A |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| RNA | - | A | U | G | U | A | C | C | G | U | U | U | A | U | A | G | G | U | A | A | G | U |
DNA-dependent RNA polymerase transcribes the template strand of DNA to RNA. In this case, the RNA sequence will be complementary to the given DNA template:
Given DNA template strand (3' → 5'): TACATGGCAAATATCCATTCA
Transcribed RNA strand (5' → 3'): AUGUACCGUUUAUAGGUAAGU
Thus, the correct answer is (1) 5'AUGUACCGUUUAUAGGUAAGU3'.
The process of copying the genetic information from one strand of DNA into RNA is termed as transcription. The principle of complementarity of bases governs the process of transcription, also except that uracil comes in place of thymine. Study the complete transcription unit given below and answer the following questions:

Describe the location of (C) and (D) in the transcription unit.
The process of copying the genetic information from one strand of DNA into RNA is termed as transcription. The principle of complementarity of bases governs the process of transcription, also except that uracil comes in place of thymine. Study the complete transcription unit given below and answer the following questions:

Identify (C) and (D) in the diagram, mention their significance in the process of transcription.
The process of copying the genetic information from one strand of DNA into RNA is termed as transcription. The principle of complementarity of bases governs the process of transcription, also except that uracil comes in place of thymine. Study the complete transcription unit given below and answer the following questions:

Identify coding strand and template strand of DNA in the transcription unit.
The process of copying the genetic information from one strand of DNA into RNA is termed as transcription. The principle of complementarity of bases governs the process of transcription, also except that uracil comes in place of thymine. Study the complete transcription unit given below and answer the following questions:

Name the main enzyme involved in the process of transcription.
A constant voltage of 50 V is maintained between the points A and B of the circuit shown in the figure. The current through the branch CD of the circuit is :
The output (Y) of the given logic implementation is similar to the output of an/a …………. gate.
What is Microalbuminuria ?

In the above represented plasmid an alien piece of DNA is inserted at the EcoRI site. Which of the following strategies will be chosen to select the recombinant colonies?