DNA | - | T | A | C | A | T | G | G | C | A | A | A | T | A | T | C | C | A | T | T | C | A |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
RNA | - | A | U | G | U | A | C | C | G | U | U | U | A | U | A | G | G | U | A | A | G | U |
DNA-dependent RNA polymerase transcribes the template strand of DNA to RNA. In this case, the RNA sequence will be complementary to the given DNA template:
Given DNA template strand (3' → 5'): TACATGGCAAATATCCATTCA
Transcribed RNA strand (5' → 3'): AUGUACCGUUUAUAGGUAAGU
Thus, the correct answer is (1) 5'AUGUACCGUUUAUAGGUAAGU3'.
The process of copying the genetic information from one strand of DNA into RNA is termed as transcription. The principle of complementarity of bases governs the process of transcription, also except that uracil comes in place of thymine. Study the complete transcription unit given below and answer the following questions:
Describe the location of (C) and (D) in the transcription unit.
The process of copying the genetic information from one strand of DNA into RNA is termed as transcription. The principle of complementarity of bases governs the process of transcription, also except that uracil comes in place of thymine. Study the complete transcription unit given below and answer the following questions:
Identify (C) and (D) in the diagram, mention their significance in the process of transcription.
The process of copying the genetic information from one strand of DNA into RNA is termed as transcription. The principle of complementarity of bases governs the process of transcription, also except that uracil comes in place of thymine. Study the complete transcription unit given below and answer the following questions:
Identify coding strand and template strand of DNA in the transcription unit.
The process of copying the genetic information from one strand of DNA into RNA is termed as transcription. The principle of complementarity of bases governs the process of transcription, also except that uracil comes in place of thymine. Study the complete transcription unit given below and answer the following questions:
Name the main enzyme involved in the process of transcription.
A sphere of radius R is cut from a larger solid sphere of radius 2R as shown in the figure. The ratio of the moment of inertia of the smaller sphere to that of the rest part of the sphere about the Y-axis is :
The current passing through the battery in the given circuit, is:
A bob of heavy mass \(m\) is suspended by a light string of length \(l\). The bob is given a horizontal velocity \(v_0\) as shown in figure. If the string gets slack at some point P making an angle \( \theta \) from the horizontal, the ratio of the speed \(v\) of the bob at point P to its initial speed \(v_0\) is :