Question:
Which of the following are found in extreme saline conditions?
Which of the following are found in extreme saline conditions?
Updated On: May 21, 2024
- Archaebacteria
- Eubacteria
- Cyanobacteria
- Mycobacteria
Hide Solution
Verified By Collegedunia
The Correct Option is A
Solution and Explanation
The correct option is (A): Archaebacteria.
Was this answer helpful?
0
0
Top Questions on Ecosystems
- In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is 100x (kcal m-2)yr-1, what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?
- NEET (UG) - 2024
- Biology
- Ecosystems
- Match List-I with List-II:Choose the correct answer from the options given below:
List-I (Concepts) List-II (Explanation) (A) Standing state (IV) Amount of mineral nutrients in the soil at a given time (B) Secondary productivity (II) Rate of formation of organic matter by consumers (C) Standing crop (III) Mass of living matter in a trophic level at a given time (D) Net primary productivity (I) Available biomass for the consumption of heterotrophs - CUET (UG) - 2024
- Biology
- Ecosystems
- Which of the following is/are example(s) of a lotic ecosystem?
- IIT JAM BT - 2024
- Biology
- Ecosystems
- Identify the statement which are not true for the natural ecosystem
(A) Grassland and desert are example of terrestrial ecosystem.
(B) Oceans and rivers are man-made ecosystems.
(C) Wetland and estuary are examples of aquatic ecosystem.
(D) Crop fields and aquarium are natural ecosystems.
Choose the correct answer from the option given below- CUET (UG) - 2023
- Biology
- Ecosystems
- In an ecosystem, the vertical distribution of different species occupying different levels is called.
- CUET (UG) - 2023
- Biology
- Ecosystems
View More Questions
Questions Asked in NEET exam
- The two-dimensional motion of a particle, described by \( \vec{r} = (\hat{i} + 2\hat{j}) A \cos \omega t \) is a/an:
1. parabolic path
2. elliptical path
3. periodic motion
4. simple harmonic motion
Choose the correct answer from the options given below:- NEET (UG) - 2024
- simple harmonic motion
- Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’- NEET (UG) - 2024
- Transcription
- Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b).
- NEET (UG) - 2024
- The Flower
- The reagents with which glucose does not react to give the corresponding tests/products are
A. Tollen's reagent
B. Schiff's reagent
C. HCN
D NH2OH
E. NaHSO3
Choose the correct options from the given below:- NEET (UG) - 2024
- Chemical Reactions
- \(^{290}_{82}X\stackrel{\alpha}{\rightarrow}Y\stackrel{e^+}{\rightarrow}Z\stackrel{\beta^-}{\rightarrow}P\stackrel{e^-}{\rightarrow}Q\)
In the nuclear emission stated above, the mass number and atomic number of the product Q respectively, are :- NEET (UG) - 2024
- Nuclear physics
View More Questions