Question:

Select the mismatch :

Updated On: May 21, 2024

Frankia – Alnus
Rhodospirillum – Mycorrhiza
Anabaena – Nitrogen fixer
Rhizobium – Alfalfa

Hide Solution

Verified By Collegedunia

The Correct Option is B

Solution and Explanation

The correct option is (B): Rhodospirillum – Mycorrhiza.

Was this answer helpful?

0

0

Top Questions on Transport in Plants

View More Questions

Questions Asked in NEET exam

The two-dimensional motion of a particle, described by \( \vec{r} = (\hat{i} + 2\hat{j}) A \cos \omega t \) is a/an:
1. parabolic path
2. elliptical path
3. periodic motion
4. simple harmonic motion
Choose the correct answer from the options given below:
- NEET (UG) - 2024
- simple harmonic motion
View Solution
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’
- NEET (UG) - 2024
- Transcription
View Solution
Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b).
- NEET (UG) - 2024
- The Flower
View Solution
The reagents with which glucose does not react to give the corresponding tests/products are
A. Tollen's reagent
B. Schiff's reagent
C. HCN
D NH₂OH
E. NaHSO₃
Choose the correct options from the given below:
- NEET (UG) - 2024
- Chemical Reactions
View Solution
\(^{290}_{82}X\stackrel{\alpha}{\rightarrow}Y\stackrel{e^+}{\rightarrow}Z\stackrel{\beta^-}{\rightarrow}P\stackrel{e^-}{\rightarrow}Q\)
In the nuclear emission stated above, the mass number and atomic number of the product Q respectively, are :
- NEET (UG) - 2024
- Nuclear physics
View Solution

View More Questions