Question:
Identify the correct statement.
Identify the correct statement.
Updated On: Jul 7, 2024
- In capping, methyl guanosine triphosphate is added to the 3 ' end of hnRNA.
- RNA polymerase binds with Rho factor to terminate the process of transcription in bacteria.
- The coding strand in a transcription unit is copied to an mRNA.
- Split gene arrangement is characteristic of prokaryotes.
Hide Solution
Verified By Collegedunia
The Correct Option is B
Solution and Explanation
Transcription is terminated when Rho factor binds to RNA polymerase in bacteria.
Was this answer helpful?
1
0
Top Questions on Transcription
- Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’- NEET (UG) - 2024
- Biology
- Transcription
- A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
- NEET (UG) - 2024
- Biology
- Transcription
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?
- NEET (UG) - 2023
- Biology
- Transcription
- Match List - I with List- II.
List - I (Codes) List - II (Codes for) (A) UUU (I) Phenylalanine (B) AUG (II) Initiator codon (C) CUAA (III) Terminator codon (D) GUU (IV) Valine
Choose the correct answer from the options given below:- CUET (UG) - 2023
- Biology
- Transcription
- Which of the following is a stop codon?
- CUET (UG) - 2023
- Biology
- Transcription
View More Questions
Questions Asked in NEET exam
- Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A : The potential (V) at any axial point, at 2 m distance(r) from the centre of the dipole of dipole moment vector \(\vec{P}\) of magnitude, 4 × 10-6 C m, is ± 9 × 103 V.
(Take \(\frac{1}{4\pi\epsilon_0}=9\times10^9\) SI units)
Reason R : \(V=±\frac{2P}{4\pi \epsilon_0r^2}\), where r is the distance of any axial point, situated at 2 m from the centre of the dipole.
In the light of the above statements, choose the correct answer from the options given below :- NEET (UG) - 2024
- Magnetic Field
- Given below are two statements:
Statement I: Mitochondria and chloroplasts both double membranes bound organelles.
Statement II: Inner membrane of mitochondria is relatively less permeable, as compared chloroplast. I
In the light of the above statements, choose the mis appropriate answer from the options given below- NEET (UG) - 2024
- Cell structure and organelles
- Match List I with List II:Choose the correct answer from the options given below:
List I
List II
A Mesozoic Era I Lower invertebrates B Proterozoic Era II Fish & Amphibia C Cenozoic Era III Birds & Reptiles D Paleozoic Era IV Mammals - NEET (UG) - 2024
- Origin Of Life
- A parallel plate capacitor is charged by connecting it to a battery through a resistor. If I is the current in the circuit, then in the gap between the plates :
- NEET (UG) - 2024
- Capacitors and Capacitance
- The terminal voltage of the battery, whose emf is\(10V\) and internal resistance \(1\), when connected through an external resistance of \(42\) as shown in the figure is:
- NEET (UG) - 2024
- Resistance and Resistivity
View More Questions