Given below are two statements, one is labelled as Assertion A and the other is labelled as Reason R
Assertion (A) : In eukaryotes, transcription occurs in nucleus.
Reason (R) : In bacteria, transcription and translation occurs in cytoplasm.
In the light of the above statements, choose the correct answer from the options given below
Given below are two statements, one is labelled as Assertion A and the other is labelled as Reason R
Assertion (A) : In eukaryotes, transcription occurs in nucleus.
Reason (R) : In bacteria, transcription and translation occurs in cytoplasm.
In the light of the above statements, choose the correct answer from the options given below
- If both assertion and reason are true and reason is the correct explanation of assertion
- If both assertion and reason are true but reason is not the correct explanation of assertion
- If assertion is true but reason is false
- If both assertion and reason are false
The Correct Option is B
Solution and Explanation
Answer (b) If both assertion and reason are true but reason is not the correct explanation of assertion
Assertion : In eukaryotes, transcription occurs in nucleus. (Correct)
Reason : In bacteria, transcription and translation occurs in cytoplasm. (True but not correct explanation)
Top Questions on Transcription
The process of copying the genetic information from one strand of DNA into RNA is termed as transcription. The principle of complementarity of bases governs the process of transcription, also except that uracil comes in place of thymine. Study the complete transcription unit given below and answer the following questions:
Identify (C) and (D) in the diagram, mention their significance in the process of transcription.
- CBSE CLASS XII - 2025
- Biology
- Transcription
The process of copying the genetic information from one strand of DNA into RNA is termed as transcription. The principle of complementarity of bases governs the process of transcription, also except that uracil comes in place of thymine. Study the complete transcription unit given below and answer the following questions:
Describe the location of (C) and (D) in the transcription unit.
- CBSE CLASS XII - 2025
- Biology
- Transcription
The process of copying the genetic information from one strand of DNA into RNA is termed as transcription. The principle of complementarity of bases governs the process of transcription, also except that uracil comes in place of thymine. Study the complete transcription unit given below and answer the following questions:
Name the main enzyme involved in the process of transcription.
- CBSE CLASS XII - 2025
- Biology
- Transcription
The process of copying the genetic information from one strand of DNA into RNA is termed as transcription. The principle of complementarity of bases governs the process of transcription, also except that uracil comes in place of thymine. Study the complete transcription unit given below and answer the following questions:
Identify coding strand and template strand of DNA in the transcription unit.
- CBSE CLASS XII - 2025
- Biology
- Transcription
- Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’- NEET (UG) - 2024
- Biology
- Transcription
Questions Asked in AIIMS exam
Given below are two statements, one is labelled as Assertion A and the other is labelled as Reason R
Assertion (A) : 02 is liberated in the non-cyclic photophosphorylation.
Reason (R) : Liberation of oxygen is due to photolysis of water.
In the light of the above statements, choose the correct answer from the options given below
- AIIMS - 2019
- Photosynthesis in higher plants
- Which gas is present predominantly in biogas
- AIIMS - 2019
- Aerobic Respiration
- Match the following column I with column II.
- AIIMS - 2019
- cloning
Given below are two statements, one is labelled as Assertion A and the other is labelled as Reason R
Assertion (A) : The Cro-Magnon man was the direct ancestor of the living modern man.
Reason (R) : Cro-Magnon man had slightly prognathous face.
In the light of the above statements, choose the correct answer from the options given below
- AIIMS - 2019
- evolution
- Given below are two statements, one is labelled as Assertion A and the other is labelled as Reason R
Assertion: Orbit of a satellite is within the gravitational field of earth whereas escaping is beyond the gravitational field of earth.
Reason: Orbital velocity of a satellite is greater than its escape velocity.
In the light of the above statements, choose the correct answer from the options given below- AIIMS - 2019
- Gravitation
Concepts Used:
Transcription
The very first stage of gene expression is the procedure of transcription. In this procedure, mRNA is the place where the genetic information is stored which later aids in encoding a protein. In this process, the DNA strand acts as a guide in the making of mRNA. Despite the fact that there is one exception which is adenine base pairs with uracil instead of thymine.
Transcription Unit:
The transcription unit is a set of freshly combined RNA molecules that have been transcribed from DNA. The cause is to encode at least one gene. A protein that has been encoded or encrypted with a DNA transcription unit may have a coding sequence. Transcription has a lower copying fidelity rate when differentiated from DNA replication.
The Stages of Transcription:
The procedure of transcription is enzymatically catalyzed into three steps:
- Initiation
- Elongation
- Termination