Question:
During DNA replication, Okazaki fragments are used to elongate
During DNA replication, Okazaki fragments are used to elongate
Updated On: May 21, 2024
- The leading strand towards replication fork
- The lagging strand towards replication fork
- The leading strand away from replication fork
- The lagging strand away from the replication fork
Hide Solution
Verified By Collegedunia
The Correct Option is D
Solution and Explanation
The correct option is (D): The lagging strand away from the replication fork.
Was this answer helpful?
0
0
Top Questions on DNA replication, transcription and translation
- Which one or more of the following statements correctly describe(s) the changes upon the addition of puromycin during eukaryotic translation?
- GATE XL - 2024
- Biochemistry
- DNA replication, transcription and translation
- Adenine constitutes 0.16 mole fraction in a given single-stranded DNA. What is the mole fraction of uracil in the resultant RNA, if this entire DNA fragment is transcribed?
- IIT JAM BT - 2024
- Biology
- DNA replication, transcription and translation
- The rate of transcription in a bacterium is 50 nucleotides/min and the average molecular weight of an amino acid is 110 Da. Time taken for synthesis of the mRNA of a protein with molecular weight of 110 kDa is min. (rounded off to one decimal place) Assume no abortive transcriptions and no sequences upstream of the start codon.
- IIT JAM BT - 2023
- Biology
- DNA replication, transcription and translation
- The sequence of nitrogen bases of the temple strand of DNA in a transcription unit is 3'-ATTGAACTG-5'. The sequence of nitrogen bases in its mRNA transcription would be:
- CUET (UG) - 2023
- Biology
- DNA replication, transcription and translation
- Which of the following mRNA can be transcripted as
- JIPMER MBBS - 2018
- Biology
- DNA replication, transcription and translation
View More Questions
Questions Asked in NEET exam
- The two-dimensional motion of a particle, described by \( \vec{r} = (\hat{i} + 2\hat{j}) A \cos \omega t \) is a/an:
1. parabolic path
2. elliptical path
3. periodic motion
4. simple harmonic motion
Choose the correct answer from the options given below:- NEET (UG) - 2024
- simple harmonic motion
- Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’- NEET (UG) - 2024
- Transcription
- Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b).
- NEET (UG) - 2024
- The Flower
- The reagents with which glucose does not react to give the corresponding tests/products are
A. Tollen's reagent
B. Schiff's reagent
C. HCN
D NH2OH
E. NaHSO3
Choose the correct options from the given below:- NEET (UG) - 2024
- Chemical Reactions
- \(^{290}_{82}X\stackrel{\alpha}{\rightarrow}Y\stackrel{e^+}{\rightarrow}Z\stackrel{\beta^-}{\rightarrow}P\stackrel{e^-}{\rightarrow}Q\)
In the nuclear emission stated above, the mass number and atomic number of the product Q respectively, are :- NEET (UG) - 2024
- Nuclear physics
View More Questions