Question:
Double fertilization is exhibited by
Double fertilization is exhibited by
Updated On: May 21, 2024
- Gymnosperms
- Algae
- Fungi
- Angiosperms
Hide Solution
Verified By Collegedunia
The Correct Option is D
Solution and Explanation
The correct option is (D): Angiosperms.
Was this answer helpful?
0
0
Top Questions on Double Fertilisation
- Assertion: Insects are important pollinators for many flowering plants. Reasoning: Insects visit flowers to obtain nectar or pollen, and in the process, they inadvertently transfer pollen from one flower to another, facilitating cross-pollination.
- MHT CET - 2024
- Biology
- Double Fertilisation
- Which of the following flowers is most likely to be pollinated by birds?
- MHT CET - 2024
- Biology
- Double Fertilisation
- Which of the following is an example of an outbreeding device in plants?
- MHT CET - 2024
- Biology
- Double Fertilisation
- During double fertilization in angiosperms, which of the following events occurs?
- MHT CET - 2024
- Biology
- Double Fertilisation
Large, colourful, fragrant flowers with nectar are seen in
- NEET (UG) - 2023
- Biology
- Double Fertilisation
View More Questions
Questions Asked in NEET exam
- The two-dimensional motion of a particle, described by \( \vec{r} = (\hat{i} + 2\hat{j}) A \cos \omega t \) is a/an:
1. parabolic path
2. elliptical path
3. periodic motion
4. simple harmonic motion
Choose the correct answer from the options given below:- NEET (UG) - 2024
- simple harmonic motion
- Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’- NEET (UG) - 2024
- Transcription
- Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b).
- NEET (UG) - 2024
- The Flower
- The reagents with which glucose does not react to give the corresponding tests/products are
A. Tollen's reagent
B. Schiff's reagent
C. HCN
D NH2OH
E. NaHSO3
Choose the correct options from the given below:- NEET (UG) - 2024
- Chemical Reactions
- \(^{290}_{82}X\stackrel{\alpha}{\rightarrow}Y\stackrel{e^+}{\rightarrow}Z\stackrel{\beta^-}{\rightarrow}P\stackrel{e^-}{\rightarrow}Q\)
In the nuclear emission stated above, the mass number and atomic number of the product Q respectively, are :- NEET (UG) - 2024
- Nuclear physics
View More Questions