Question:
A spring of force constant k is cut into lengths of ratio 1 : 2 : 3. They are connected in series and the new force constant is k'. Then they are connected in parallel and force constant is k''. Then k' : k'' is
A spring of force constant k is cut into lengths of ratio 1 : 2 : 3. They are connected in series and the new force constant is k'. Then they are connected in parallel and force constant is k''. Then k' : k'' is
Updated On: May 21, 2024
- 1 : 6
- 1 : 9
- 1 : 11
- 1 : 14
Hide Solution
Verified By Collegedunia
The Correct Option is C
Solution and Explanation
The correct option is (C): 1 : 11.
Was this answer helpful?
0
0
Top Questions on Oscillations
- For the oscillations of a spring with spring constant k, the false statement is
- KEAM - 2025
- Physics
- Oscillations
- A simple pendulum has a length of $ L = 2 \, \text{m} $. What is the time period of the pendulum? (Assume $ g = 9.8 \, \text{m/s}^2 $)
- MHT CET - 2025
- Physics
- Oscillations
- A mass of 0.5 kg is attached to a spring of force constant 200 N/m. What is the time period of oscillation?
- MHT CET - 2025
- Physics
- Oscillations
- A mass of 0.5 kg is attached to a spring of force constant 200 N/m. What is the time period of oscillation?
- MHT CET - 2025
- Physics
- Oscillations
- Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A): Time period of a simple pendulum is longer at the top of a mountain than that at the base of the mountain.
Reason (R): Time period of a simple pendulum decreases with increasing value of acceleration due to gravity and vice-versa. In the light of the above statements, choose the most appropriate answer from the options given below:- JEE Main - 2025
- Physics
- Oscillations
View More Questions
Questions Asked in NEET exam
- What is the fate of a piece of DNA carrying only gene of interest which is transfered in to an alien organism?
A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.
B. It may get integrated into the genome of the recipient.
C. It may multiple and be inherited along with the host DNA.
D. The alien piece of DNA is not an integral part of chromasame.
E. It shows ability to replicate.
Choose the correct answer from the options given below: - In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is 100x (kcal m-2)yr-1, what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?
- NEET (UG) - 2024
- Ecosystems
- A bob is whirled in a horizontal circle by means of a string at an initial speed of 10 rpm. If the tension in the string is quadrupled while keeping the radius constant, the new speed is:
- NEET (UG) - 2024
- Circular motion
- The two-dimensional motion of a particle, described by \( \vec{r} = (\hat{i} + 2\hat{j}) A \cos \omega t \) is a/an:
1. parabolic path
2. elliptical path
3. periodic motion
4. simple harmonic motion
Choose the correct answer from the options given below:- NEET (UG) - 2024
- simple harmonic motion
- Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’- NEET (UG) - 2024
- Transcription
View More Questions