Which of the following is the pribnow box?
- $ 5\,TATAAT\,3 $
- $ 5\,TAATTA\,3 $
- $ 5AATAAT\,3 $
- $ 5ATATTA\,3 $
The Correct Option is A
Solution and Explanation
Top Questions on Transcription
The process of copying the genetic information from one strand of DNA into RNA is termed as transcription. The principle of complementarity of bases governs the process of transcription, also except that uracil comes in place of thymine. Study the complete transcription unit given below and answer the following questions:
Identify (C) and (D) in the diagram, mention their significance in the process of transcription.
- CBSE CLASS XII - 2025
- Biology
- Transcription
The process of copying the genetic information from one strand of DNA into RNA is termed as transcription. The principle of complementarity of bases governs the process of transcription, also except that uracil comes in place of thymine. Study the complete transcription unit given below and answer the following questions:
Describe the location of (C) and (D) in the transcription unit.
- CBSE CLASS XII - 2025
- Biology
- Transcription
The process of copying the genetic information from one strand of DNA into RNA is termed as transcription. The principle of complementarity of bases governs the process of transcription, also except that uracil comes in place of thymine. Study the complete transcription unit given below and answer the following questions:
Name the main enzyme involved in the process of transcription.
- CBSE CLASS XII - 2025
- Biology
- Transcription
The process of copying the genetic information from one strand of DNA into RNA is termed as transcription. The principle of complementarity of bases governs the process of transcription, also except that uracil comes in place of thymine. Study the complete transcription unit given below and answer the following questions:
Identify coding strand and template strand of DNA in the transcription unit.
- CBSE CLASS XII - 2025
- Biology
- Transcription
- Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’- NEET (UG) - 2024
- Biology
- Transcription
Questions Asked in Manipal exam
- Pressure inside two soap bubbles are 1.01 atm and 1.03 atm. Ratio between their volumes is
- Manipal - 2013
- Surface tension
- Who has written the book Genera Plantarum?
- Manipal - 2013
- Nomenclature and taxonomy
- There is loss in weight when mixture of $ L{{i}_{2}}C{{O}_{3}} $ and $ N{{a}_{2}}C{{O}_{3}}.10{{H}_{2}}O $ is heated strongly. This loss is due to
- Manipal - 2013
- anomalous behaviour of lithium
- The main function of clitellum is
- Manipal - 2013
- earthworm
- The distance between the two successive nodes is
Concepts Used:
Transcription
The very first stage of gene expression is the procedure of transcription. In this procedure, mRNA is the place where the genetic information is stored which later aids in encoding a protein. In this process, the DNA strand acts as a guide in the making of mRNA. Despite the fact that there is one exception which is adenine base pairs with uracil instead of thymine.
Transcription Unit:
The transcription unit is a set of freshly combined RNA molecules that have been transcribed from DNA. The cause is to encode at least one gene. A protein that has been encoded or encrypted with a DNA transcription unit may have a coding sequence. Transcription has a lower copying fidelity rate when differentiated from DNA replication.
The Stages of Transcription:
The procedure of transcription is enzymatically catalyzed into three steps:
- Initiation
- Elongation
- Termination