Question:
Which of the following is a stop codon?
Which of the following is a stop codon?
Updated On: Apr 19, 2024
- UAC
- UAG
- UAU
- AUG
Hide Solution
Verified By Collegedunia
The Correct Option is B
Solution and Explanation
The correct option is (B): UAG
Was this answer helpful?
0
0
Top Questions on Transcription
- Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’- NEET (UG) - 2024
- Biology
- Transcription
- A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
- NEET (UG) - 2024
- Biology
- Transcription
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?
- NEET (UG) - 2023
- Biology
- Transcription
- Match List - I with List- II.
List - I (Codes) List - II (Codes for) (A) UUU (I) Phenylalanine (B) AUG (II) Initiator codon (C) CUAA (III) Terminator codon (D) GUU (IV) Valine
Choose the correct answer from the options given below:- CUET (UG) - 2023
- Biology
- Transcription
- Identify the correct statement.
- NEET (UG) - 2021
- Biology
- Transcription
View More Questions
Questions Asked in CUET exam
- A molecule X associates in a given solvent as per the following equation:
X ⇌ (X)n
For a given concentration of X, the van’t Hoff factor was found to be 0.80 and the
fraction of associated molecules was 0.3. The correct value of ‘n’ is:- CUET (UG) - 2024
- Solutions
- Who devised the concept of Intelligence Quotient (IQ)?
- CUET (UG) - 2024
- Psychological attributes
- Two pipes A and B can fill a tank in 32 minutes and 48 minutes respectively. If both the pipes are opened simultaneously, after how much time B should be turned off so that the tank is full in 20 minutes?
- CUET (UG) - 2024
- Time and Work
- If \(A = \begin{bmatrix} 3 & 2 \\ -1 & 1 \end{bmatrix} \quad \text{and} \quad B = \begin{bmatrix} -1 & 0 \\ 2 & 5 \\ 3 & 4 \end{bmatrix},\)then \((BA)^T\) is equal to:
- CUET (UG) - 2024
- Matrices
- The spin-only magnetic moment of Hexacyanomanganate(II) ion is.........BM
- CUET (UG) - 2024
- Magnetic moment
View More Questions