Question:
Genes in two species that are derived from the same ancestral gene in their most recent common ancestor are called
Genes in two species that are derived from the same ancestral gene in their most recent common ancestor are called
Updated On: Jan 9, 2025
- analogs
- heterologs
- orthologs
- paralogs
Hide Solution
Verified By Collegedunia
The Correct Option is C
Solution and Explanation
Orthologs are genes in different species that evolved from a common ancestral gene. They retain the same function across species, unlike paralogs, which arise by duplication within the same genome.
Was this answer helpful?
0
0
Top Questions on Inheritance Of Two Genes
- (a) Draw a diagram of a human sperm. Label any four parts and write their functions.
- CBSE CLASS XII - 2024
- Biology
- Inheritance Of Two Genes
(b) Explain the events which occur within a female Anopheles mosquito after it has sucked blood from a malaria patient.
- CBSE CLASS XII - 2024
- Biology
- Inheritance Of Two Genes
- Study the graph given below that represents the changes in the thickening of the uterine wall in women βXβ and women βYβ over a period of one month: \textit{(Refer to the provided graph.)}
What does the graph with respect to woman βXβ and woman βYβ indicate? Give a suitable reason.- CBSE CLASS XII - 2024
- Biology
- Inheritance Of Two Genes
- Consider the given data of a hypothetical small portion of mRNA that codes for a functional polypeptide chain and answer the questions that follow:
mRNA Sequence: 5ββ UCAUUAACCCAGAUCUUCUUAAAAGGA β3β
How many amino acids will be formed from the given codons, if substitution of βUβ by βCβ takes place at the 5th codon? Explain your answer.- CBSE CLASS XII - 2024
- Biology
- Inheritance Of Two Genes
- Which of the chromosome in a human possesses the least number of genes?
- CBSE CLASS XII - 2024
- Biology
- Inheritance Of Two Genes
View More Questions
Questions Asked in IIT JAM BT exam
- A box of mass 20 ππ is pulled at constant speed across a floor by a rope. The rope makes an angle of 45Β° with the horizontal. Assuming that friction is negligible, the work done in pulling the box by a distance of 20 π is _____ π½ (rounded off to the nearest integer). (Use $π = 9.8 ππ ^{β2}$)
- IIT JAM BT - 2024
- Friction
- The value of $\lim_{π₯β3}\frac{(π₯^2 β9)}{(π₯^2β4π₯+3 )} $ is (rounded off to the nearest integer).
- IIT JAM BT - 2024
- Limits and derivations
- Which one of the following statements about polyploidy is correct?
- IIT JAM BT - 2024
- Genetics
- A ball dropped from a bridge hits the surface of the water in 3 π . The height of the bridge, ignoring air resistance, is ___ π (rounded off to one decimal place). (Use $π = 9.8 ππ ^{β2}$)
- IIT JAM BT - 2024
- Motion in a plane
- The restriction map of a circular plasmid is shown below, along with the indicated distances between the restriction sites.
The plasmid was completely digested with EcoRI, and XhoI. The products were analysed by agarose gel electrophoresis followed by ethidium bromide staining. The number of bands that will be visible in the gel when exposed to UV light is __________.- IIT JAM BT - 2024
- Biotechnology
View More Questions